View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9421_low_38 (Length: 248)

Name: NF9421_low_38
Description: NF9421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9421_low_38
NF9421_low_38
[»] chr1 (1 HSPs)
chr1 (9-233)||(32460456-32460683)


Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 233
Target Start/End: Complemental strand, 32460683 - 32460456
Alignment:
9 ggtggtgagggattcgaactcgggcgagtcgatgagaatcgttcctaaagcgagtt---tcggaagtttgtgagataaaaacgaggtcgtaaaagcgata 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||| |||||||||||||||    
32460683 ggtggtgagggattcgaactcgggcgagtcgatgagaatcgttcctaaagcgagttgtttcggaagtttgtgagataaaaacgacgtcgtaaaagcgata 32460584  T
106 accggtttagagaggttaacgagatgagaaatttctgagggagtggaaattgggtttgttggtgaaacaacgacgccaatggagagcaatgcgaagtaga 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
32460583 accggtttagagaggttaacgagatgagaaatttctgagggagtggagattgggtttgttggtgaaacaacgacgccaatggagagcaatgcgaagtaga 32460484  T
206 ggattggaacctgaacgaggtttgggga 233  Q
    ||||||||||||||||||||||||||||    
32460483 ggattggaacctgaacgaggtttgggga 32460456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University