View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9421_low_38 (Length: 248)
Name: NF9421_low_38
Description: NF9421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9421_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 233
Target Start/End: Complemental strand, 32460683 - 32460456
Alignment:
| Q |
9 |
ggtggtgagggattcgaactcgggcgagtcgatgagaatcgttcctaaagcgagtt---tcggaagtttgtgagataaaaacgaggtcgtaaaagcgata |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32460683 |
ggtggtgagggattcgaactcgggcgagtcgatgagaatcgttcctaaagcgagttgtttcggaagtttgtgagataaaaacgacgtcgtaaaagcgata |
32460584 |
T |
|
| Q |
106 |
accggtttagagaggttaacgagatgagaaatttctgagggagtggaaattgggtttgttggtgaaacaacgacgccaatggagagcaatgcgaagtaga |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32460583 |
accggtttagagaggttaacgagatgagaaatttctgagggagtggagattgggtttgttggtgaaacaacgacgccaatggagagcaatgcgaagtaga |
32460484 |
T |
|
| Q |
206 |
ggattggaacctgaacgaggtttgggga |
233 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32460483 |
ggattggaacctgaacgaggtttgggga |
32460456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University