View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9421_low_54 (Length: 213)
Name: NF9421_low_54
Description: NF9421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9421_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 23 - 199
Target Start/End: Complemental strand, 39704282 - 39704105
Alignment:
| Q |
23 |
ttcactgctttgatatttttgtgtatataacaaaaacaaccacttatctcactaagtgacgtcggctatatcgatcaa-ttacgtcataatattgtataa |
121 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
39704282 |
ttcactgctttgatatttttgtgtatacaacaaaaacaatcacttatctcactaagtgacgtcggctatatccatcaaattacgtcataatattgtataa |
39704183 |
T |
 |
| Q |
122 |
catatcatatccctatccaattcattgatctctatatctatcttgatagtttattctcttataagttttttaggtttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39704182 |
catatcatatccctatccaattcattgatctctatatctatcttgatactttattctcttataagttttttaggtttt |
39704105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 165
Target Start/End: Original strand, 40018264 - 40018306
Alignment:
| Q |
123 |
atatcatatccctatccaattcattgatctctatatctatctt |
165 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||| |||| |
|
|
| T |
40018264 |
atatcatatccctatccaactcattgatctctagatctttctt |
40018306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 124 - 173
Target Start/End: Original strand, 9917526 - 9917575
Alignment:
| Q |
124 |
tatcatatccctatccaattcattgatctctatatctatcttgatagttt |
173 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||| ||| ||||||| |
|
|
| T |
9917526 |
tatcatatctctatccaactcattgatctctatatctttctaaatagttt |
9917575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University