View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9421_low_55 (Length: 209)

Name: NF9421_low_55
Description: NF9421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9421_low_55
NF9421_low_55
[»] chr4 (1 HSPs)
chr4 (12-190)||(31563763-31563941)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 12 - 190
Target Start/End: Complemental strand, 31563941 - 31563763
Alignment:
12 agcagagacggcagtattaccaaaaggtgtgaacgaaggtggctcatggggaagaggattcatcctgcctggaggaggtcttaaaggtggcattccagaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31563941 agcagagacggcagtattaccaaaaggtgtgaacgaaggtggctcatggggaagaggattcatcctgcctggaggaggtcttaaaggtggcattccagaa 31563842  T
112 tggatagttcccactctcccaggaggaggattcaattcaaatggcgatccgacagcagcaaaagctcccatcgattgat 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
31563841 tggatagttcccactctcccaggaggaggattcaattcaaatggcgatccgacaacagcaaaagctcccatcgattgat 31563763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University