View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9421_low_57 (Length: 208)
Name: NF9421_low_57
Description: NF9421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9421_low_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 17 - 127
Target Start/End: Complemental strand, 43075173 - 43075063
Alignment:
| Q |
17 |
catcaacgaccgttcaatggaacttaaaatgctacaatgtaagtaacatacacttcaccttcttaactttgaaccaataataaataaagggtcacaatcc |
116 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43075173 |
catcaatgaccgttcaatggaacttaaaatgctacaatgtaagtaacatacacttcaccttcttaactttgaaccaataataaataaagggtcactatcc |
43075074 |
T |
|
| Q |
117 |
ttgtgtttctt |
127 |
Q |
| |
|
||||||||||| |
|
|
| T |
43075073 |
ttgtgtttctt |
43075063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University