View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9421_low_60 (Length: 205)
Name: NF9421_low_60
Description: NF9421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9421_low_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 18 - 143
Target Start/End: Original strand, 13521323 - 13521448
Alignment:
| Q |
18 |
gaaatagatgtgtttgctgttcgattaagattgattttgaggtaaaaattattatattttatcaaattaaacaaagttagaattggatcgattcattaaa |
117 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13521323 |
gaaatagatgtgtttgctgtttgactaagattgattttgaggtaaaaattattatattttatcaaattaaacaaagttagaattggatcgattcattaaa |
13521422 |
T |
 |
| Q |
118 |
ggtttatcgatatataattatatatt |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
13521423 |
ggtttatcgatatataattatatatt |
13521448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University