View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9423_low_8 (Length: 207)
Name: NF9423_low_8
Description: NF9423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9423_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 1039143 - 1038946
Alignment:
| Q |
1 |
ttcttggagaataagttttttcctttcactacttttaatattgaaaatactccccggtctttttggattgtgctggttcgcaaagaaaataattagttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1039143 |
ttcttggagaataagttttttcctttcactacttttaatattgaaaatactctccggtctctttggattgtgctggttcgcaaag-aaataattagttgc |
1039045 |
T |
|
| Q |
101 |
tcttc-tttgcaagtctt-atgctagagagtagagctctctctttgtggtaatatatctcatttttgttagttnnnnnnnntggtaaaattagtattat |
197 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1039044 |
tcttcttttgcaagtcttgttgctagagagtagagctctccctttgtggtaatatatctcatttttgttagttaaaaaaaatggtaaaattagtattat |
1038946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 97 - 164
Target Start/End: Original strand, 20248894 - 20248961
Alignment:
| Q |
97 |
ttgctcttctttgcaagtcttatgctagagagtagagctctctctttgtggtaatatatctcattttt |
164 |
Q |
| |
|
||||||||||||||| | ||| |||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
20248894 |
ttgctcttctttgcacgccttgtgctagagagtagagctctcactttgtggtgatatatctcattttt |
20248961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 125 - 167
Target Start/End: Complemental strand, 42674843 - 42674801
Alignment:
| Q |
125 |
agagtagagctctctctttgtggtaatatatctcatttttgtt |
167 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
42674843 |
agagtagagctctccctttgtggtaatgtatctcatttttgtt |
42674801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 97 - 167
Target Start/End: Complemental strand, 14550982 - 14550912
Alignment:
| Q |
97 |
ttgctcttctttgcaagtcttatgctagagagtagagctctctctttgtggtaatatatctcatttttgtt |
167 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
14550982 |
ttgctcttctttgcacatcttgtgctaaagagtagagccctccctttatggtaatatatctcatttttgtt |
14550912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 97 - 167
Target Start/End: Original strand, 40526139 - 40526209
Alignment:
| Q |
97 |
ttgctcttctttgcaagtcttatgctagagagtagagctctctctttgtggtaatatatctcatttttgtt |
167 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||| || |||||||||| | ||||||| |
|
|
| T |
40526139 |
ttgctcttctttgcacaccttgtgctagagagtagagctctccctttttgataatatatcttagttttgtt |
40526209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 125 - 167
Target Start/End: Original strand, 29246356 - 29246398
Alignment:
| Q |
125 |
agagtagagctctctctttgtggtaatatatctcatttttgtt |
167 |
Q |
| |
|
|||||| | ||||||||||||| |||||||||||||||||||| |
|
|
| T |
29246356 |
agagtaaaactctctctttgtgataatatatctcatttttgtt |
29246398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 122 - 167
Target Start/End: Complemental strand, 30819136 - 30819091
Alignment:
| Q |
122 |
tagagagtagagctctctctttgtggtaatatatctcatttttgtt |
167 |
Q |
| |
|
||||||||||| || | |||||||| |||||||||||||||||||| |
|
|
| T |
30819136 |
tagagagtagatctttttctttgtgataatatatctcatttttgtt |
30819091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 115 - 167
Target Start/End: Complemental strand, 29000205 - 29000153
Alignment:
| Q |
115 |
cttatgctagagagtagagctctctctttgtggtaatatatctcatttttgtt |
167 |
Q |
| |
|
|||||||||||||||| || | |||||| |||||||||||||||||||||| |
|
|
| T |
29000205 |
cttatgctagagagtacttctttttctttgaggtaatatatctcatttttgtt |
29000153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 167
Target Start/End: Complemental strand, 22816438 - 22816390
Alignment:
| Q |
119 |
tgctagagagtagagctctctctttgtggtaatatatctcatttttgtt |
167 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
22816438 |
tgctagagagtagagctcttccttaatggtattatatctcatttttgtt |
22816390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University