View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9425_low_13 (Length: 252)
Name: NF9425_low_13
Description: NF9425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9425_low_13 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 252
Target Start/End: Original strand, 2328344 - 2328580
Alignment:
| Q |
13 |
cagagaacattttcaagtgggtatctaattggccaaaaattgttgatgcaatttctactatttgtagactaatggatgaaattgtgaccagtgaggtatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2328344 |
cagagaacattttcaagtgggtatctaattggccaaaaattgttgatgcaatttctactatttgtagactaatggatgaaattgtgaccagtgaggtatt |
2328443 |
T |
 |
| Q |
113 |
tatatatcacatctatatctagatatatagaaaatttaagctttatttctctctaatgtaagttttttacacaatagaaattgttgcattgannnnnnnn |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2328444 |
tatatatcacatctatatctagatatatagaaaatttaagctttatttctctctaatgtaagttttttacacaatagaaattgttgcattga---ttttt |
2328540 |
T |
 |
| Q |
213 |
nnnnnnattacatagtttgaacgtaaaagaggacatgttt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2328541 |
ttttttattacatagtttgaacgtaaaagaggacatgttt |
2328580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University