View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9425_low_21 (Length: 202)
Name: NF9425_low_21
Description: NF9425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9425_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 18 - 129
Target Start/End: Original strand, 28778851 - 28778962
Alignment:
| Q |
18 |
tgagagagaacatccatggctaggcggcgagtcgagactcagaacgagtcgttattgactcggattgttgattccattttcgcctttgtgagaaatgctg |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
28778851 |
tgagagagaacatcgatggctaggcggcgagtcgagactcagaacgagtcgttattgactcggattgttgattccattttcgccttcgtgagaaatgccg |
28778950 |
T |
|
| Q |
118 |
agtttgagatcc |
129 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28778951 |
agtttgagatcc |
28778962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University