View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9425_low_8 (Length: 262)
Name: NF9425_low_8
Description: NF9425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9425_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 20951721 - 20951547
Alignment:
| Q |
1 |
tcgatcttcaaaattcgtttataagatgaaaatcgcttcagacttaaaaccactatttggcctatatgttaaccatccaaaatggttaagatgcattgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20951721 |
tcgatcttcaaaattcgtttataagatgaaaattgcttcggacttaaaaccactatttggcctatatgttaactatccaaaatggttaagatgcattgtt |
20951622 |
T |
|
| Q |
101 |
gattagactaaccttgtaaatttcatacaagcataaatgccttattataattaaaatgtgattaattaaccttga |
175 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20951621 |
gattagactaaccttgtaaatttcatagaagcataaatgtcttattataattaaaatgtgattaattaaccttga |
20951547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 172 - 245
Target Start/End: Complemental strand, 20951513 - 20951440
Alignment:
| Q |
172 |
ttgatattatatttaattacatgtatagatggataaggcttctataattggagatgctgtttcatatatgcatg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20951513 |
ttgatattatatttaattacatgtatagatggataaggcttctataattggagatgctgtttcatatatgcatg |
20951440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 198 - 245
Target Start/End: Original strand, 35474246 - 35474293
Alignment:
| Q |
198 |
agatggataaggcttctataattggagatgctgtttcatatatgcatg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||| |||||| |
|
|
| T |
35474246 |
agatggataaggcttctataattggagatgcagtatcatatgtgcatg |
35474293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University