View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9426_high_19 (Length: 224)
Name: NF9426_high_19
Description: NF9426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9426_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 9574789 - 9574980
Alignment:
| Q |
18 |
agttttgcctttgtattcacatgtgtgggtgatgacttgccagcagacatacatgtgtgctcaataacttcctctgcatatttattttgagaaagaaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9574789 |
agttttgcctttgtattcacatgtatgggtgatgacttgccagtagacatacatgtgtgctcaataacttcctctgcatatttattttgagaaagaaaaa |
9574888 |
T |
 |
| Q |
118 |
taactggacggg--tgatgacttcacgaaaaattcaaagttaagcttagacataatcaattcataaagagagtcagaagaagcggcaagaat |
207 |
Q |
| |
|
|||||||||||| | | ||||| | ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9574889 |
taactggacgggcctcaatccttcatggaaaattcaaagttaagcttagacataatcaattcataaagatagtcagaagaagcggcaagaat |
9574980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University