View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9426_low_35 (Length: 249)
Name: NF9426_low_35
Description: NF9426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9426_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 87 - 223
Target Start/End: Complemental strand, 37793876 - 37793742
Alignment:
| Q |
87 |
gaagaatcgtcgtaaagcattaaatgtaaaataaagcaggaatattcttcttattactattaactattttgagagatagagagagatggtaaacaaaaaa |
186 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37793876 |
gaagaatcgtcataaagcattaaatgtaaaataaagcaggaatattcttcttatta--attaactattttgagagatagagagagatggtaaacaaaaaa |
37793779 |
T |
 |
| Q |
187 |
tatagaagcgagaaagaaatgctattttatttcaaat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37793778 |
tatagaagcgagaaagaaatgctattttatttcaaat |
37793742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University