View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9426_low_39 (Length: 224)

Name: NF9426_low_39
Description: NF9426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9426_low_39
NF9426_low_39
[»] chr2 (1 HSPs)
chr2 (18-207)||(9574789-9574980)


Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 9574789 - 9574980
Alignment:
18 agttttgcctttgtattcacatgtgtgggtgatgacttgccagcagacatacatgtgtgctcaataacttcctctgcatatttattttgagaaagaaaaa 117  Q
    |||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9574789 agttttgcctttgtattcacatgtatgggtgatgacttgccagtagacatacatgtgtgctcaataacttcctctgcatatttattttgagaaagaaaaa 9574888  T
118 taactggacggg--tgatgacttcacgaaaaattcaaagttaagcttagacataatcaattcataaagagagtcagaagaagcggcaagaat 207  Q
    ||||||||||||  | |   ||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
9574889 taactggacgggcctcaatccttcatggaaaattcaaagttaagcttagacataatcaattcataaagatagtcagaagaagcggcaagaat 9574980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University