View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9426_low_9 (Length: 440)
Name: NF9426_low_9
Description: NF9426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9426_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-140; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 1 - 355
Target Start/End: Original strand, 2872273 - 2872637
Alignment:
| Q |
1 |
caattactcaataatctcatatcacttttatggnnnnnnnnnnnnngtcatgtgtttgttaatacatatatttttcttttagagttgggattgagattcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2872273 |
caattactcaataatctcatatcacttttatgggttttttattt--gtcatgtgtttgttaatacatatatttttcttttagagttgggattgagattcc |
2872370 |
T |
 |
| Q |
101 |
aacaattgaagttcgttttgagcacctaactattgaggcagaggcttatgtgggaagtagagcattacctagtttcacaaactttacaattggtgcagtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2872371 |
aacaattgaagttcgttttgagcacctaactattgaggcagaggcttatgtgggaagtagagcattacctagtttcacaaactttactattggtgcagtg |
2872470 |
T |
 |
| Q |
201 |
gaggtaaatttcagcacaatctagc------------gtttcttatttagannnnnnnggttagatatggtgtcaatcctataataaaattatgattgtt |
288 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2872471 |
gaggtaaatttcagcacaatctagctcatatacttgtgtttcttatttagatttttttggttagatatggtgtcaatcctataataaaattatgattgtt |
2872570 |
T |
 |
| Q |
289 |
caaccttaaaccctacaaaagttttgtttgttattcatgttttgataaacaaccttaattctatgtt |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2872571 |
caaccttaaaccctacaaaagttttgtttgttattcatgttttgataaacaaccttaatcctatgtt |
2872637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 74 - 155
Target Start/End: Original strand, 2882561 - 2882642
Alignment:
| Q |
74 |
ttcttttagagttgggattgagattccaacaattgaagttcgttttgagcacctaactattgaggcagaggcttatgtggga |
155 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| | | ||||||||||| | |||||||||| |||| ||||||| |
|
|
| T |
2882561 |
ttcttttagagttgggattgagattccagcaattgaagttagatatgagcacctaaatgttgaggcagaagcttttgtggga |
2882642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 113
Target Start/End: Complemental strand, 2902452 - 2902413
Alignment:
| Q |
74 |
ttcttttagagttgggattgagattccaacaattgaagtt |
113 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
2902452 |
ttcttttagagttggtattgagattccaacaatagaagtt |
2902413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University