View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9427_high_9 (Length: 337)
Name: NF9427_high_9
Description: NF9427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9427_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 18 - 328
Target Start/End: Complemental strand, 43805533 - 43805223
Alignment:
| Q |
18 |
tggatatccccgtggacctggtggttgtctccggtcatattttggttgtttacgacggaggaacaaggtgatggcggagagaatgaagatgagtgtgaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805533 |
tggatatccccgtggacctggtggttgtctccggtcatattttggttgtttacgacggaggaacaaggtgatggcggagagaatgaagatgagtgtgaaa |
43805434 |
T |
|
| Q |
118 |
atgagaaacaggggaagggatgaaagaaacatgttttcgatgaaaatgaggctgcttctgatttttcataagcaaagtggtggtagataagatgaaaaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805433 |
atgagaaacaggggaagggatgaaagaaacatgttttcgatgaaaatgaggctgcttctgatttttcataagcaaagtggtggtagataagatgaaaaga |
43805334 |
T |
|
| Q |
218 |
agttttgataacattttaataattggttgacaacttcaagcccccagttagtctttaccagaaccgttcaaaagcagccactgtttctccattttttgcc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805333 |
agttttgataacattttaataattggttgacaacttcaagcccccagttagtctttaccagaaccgttcaaaagcagccactgtttctccattttttgcc |
43805234 |
T |
|
| Q |
318 |
attagtataat |
328 |
Q |
| |
|
||||||||||| |
|
|
| T |
43805233 |
attagtataat |
43805223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University