View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9427_low_24 (Length: 337)

Name: NF9427_low_24
Description: NF9427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9427_low_24
NF9427_low_24
[»] chr8 (1 HSPs)
chr8 (18-328)||(43805223-43805533)


Alignment Details
Target: chr8 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 18 - 328
Target Start/End: Complemental strand, 43805533 - 43805223
Alignment:
18 tggatatccccgtggacctggtggttgtctccggtcatattttggttgtttacgacggaggaacaaggtgatggcggagagaatgaagatgagtgtgaaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43805533 tggatatccccgtggacctggtggttgtctccggtcatattttggttgtttacgacggaggaacaaggtgatggcggagagaatgaagatgagtgtgaaa 43805434  T
118 atgagaaacaggggaagggatgaaagaaacatgttttcgatgaaaatgaggctgcttctgatttttcataagcaaagtggtggtagataagatgaaaaga 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43805433 atgagaaacaggggaagggatgaaagaaacatgttttcgatgaaaatgaggctgcttctgatttttcataagcaaagtggtggtagataagatgaaaaga 43805334  T
218 agttttgataacattttaataattggttgacaacttcaagcccccagttagtctttaccagaaccgttcaaaagcagccactgtttctccattttttgcc 317  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43805333 agttttgataacattttaataattggttgacaacttcaagcccccagttagtctttaccagaaccgttcaaaagcagccactgtttctccattttttgcc 43805234  T
318 attagtataat 328  Q
    |||||||||||    
43805233 attagtataat 43805223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University