View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9427_low_27 (Length: 316)
Name: NF9427_low_27
Description: NF9427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9427_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 35 - 175
Target Start/End: Complemental strand, 41755632 - 41755493
Alignment:
| Q |
35 |
ggtaccgttgaagattttggtaccgcaaaaggacagcacaattgacaaaactcatccgacatcggctgactaattcagcccataaataatttggtaaatg |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41755632 |
ggtaccgttgaagattttggtaccgcaaaaggatagcacaattgacaaaactcatccgacatcggctgactaattcagcccataaataatttggtaaatg |
41755533 |
T |
 |
| Q |
135 |
ttaaaaatattaaatacggtataaggataattgattttctt |
175 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41755532 |
tt-aaaatattaaatacggtataaggataattgattttctt |
41755493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 193 - 299
Target Start/End: Complemental strand, 41755511 - 41755405
Alignment:
| Q |
193 |
aaggataattgattttcttaacaagcgttattgatagtactttcttcgtatagtattaaatcatttcattattccatattcataatttcatatggaccaa |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41755511 |
aaggataattgattttcttaacaagcgttattgatactactttcttcgtatagtattaaatcatttcattattccatattcataatttcatatggaccaa |
41755412 |
T |
 |
| Q |
293 |
taaatag |
299 |
Q |
| |
|
||||||| |
|
|
| T |
41755411 |
taaatag |
41755405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University