View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9427_low_28 (Length: 316)

Name: NF9427_low_28
Description: NF9427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9427_low_28
NF9427_low_28
[»] chr1 (2 HSPs)
chr1 (35-175)||(41755493-41755632)
chr1 (193-299)||(41755405-41755511)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 35 - 175
Target Start/End: Complemental strand, 41755632 - 41755493
Alignment:
35 ggtaccgttgaagattttggtaccgcaaaaggacagcacaattgacaaaactcatccgacatcggctgactaattcagcccataaataatttggtaaatg 134  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41755632 ggtaccgttgaagattttggtaccgcaaaaggatagcacaattgacaaaactcatccgacatcggctgactaattcagcccataaataatttggtaaatg 41755533  T
135 ttaaaaatattaaatacggtataaggataattgattttctt 175  Q
    || ||||||||||||||||||||||||||||||||||||||    
41755532 tt-aaaatattaaatacggtataaggataattgattttctt 41755493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 193 - 299
Target Start/End: Complemental strand, 41755511 - 41755405
Alignment:
193 aaggataattgattttcttaacaagcgttattgatagtactttcttcgtatagtattaaatcatttcattattccatattcataatttcatatggaccaa 292  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41755511 aaggataattgattttcttaacaagcgttattgatactactttcttcgtatagtattaaatcatttcattattccatattcataatttcatatggaccaa 41755412  T
293 taaatag 299  Q
    |||||||    
41755411 taaatag 41755405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University