View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9427_low_31 (Length: 288)
Name: NF9427_low_31
Description: NF9427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9427_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 13 - 271
Target Start/End: Complemental strand, 15116365 - 15116107
Alignment:
| Q |
13 |
tcgtgttcagaccagatcagacgatgccactgagacacatgagcttaagaaacaaagtgagaatgaaatgaaaaaatgtctcaattggtgggacttgatt |
112 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15116365 |
tcgtgttcagaccagatcagatgatgccactgagacacatgagcttaagaaacaaagtgagaatgaaatgaaaaaatgtctcaattggtgggacttgatt |
15116266 |
T |
|
| Q |
113 |
tggtttggctttggtgcagtaattggtgcaggaatctttgtgctaactggtcaagaagctcataaccatgcaggagcagcaatagttttatcctatgtag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15116265 |
tggtttggctttggtgcagtaattggtgcaggaatctttgtgctaactggtcaagaagctcataaccatgcaggagcagcaatagtcttatcctatgtag |
15116166 |
T |
|
| Q |
213 |
cttcaggaatatcagcaatgctttctgttttttgttacacagaatttgccgttgaagtt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15116165 |
cttcaggaatatcagcaatgctttctgttttttgttacacagaattcgccgttgaagtt |
15116107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University