View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9427_low_37 (Length: 264)
Name: NF9427_low_37
Description: NF9427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9427_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 34012093 - 34011845
Alignment:
| Q |
1 |
tgtttggaagaggttttaagcaacagttataagaaaggagacacaaatagaggagcagttgttggttgagaaaggttcttattttgtatacggtatttac |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012093 |
tgtttggaagaggctttaagcaacagttataagaaaggagacacaaatagaggagcagttgttggttgagaaaggttcttattttgtatacggtatttac |
34011994 |
T |
|
| Q |
101 |
attaaaatatacagcttcattatctatagactatagtctataccgtaatataaagtggtcatttataaatcaaaaatattattgaaatggtttgagtttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34011993 |
attaaaatatacagcttcattatctatagactatagtctataccgtaatataaagtggtcatttataaatcaaaaatattattgaaatggtttgagtttc |
34011894 |
T |
|
| Q |
201 |
actattaataaaattcttgagacttttggatgtatatatttgtggttag |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34011893 |
actattaataaaattcttgagacttttggatgtatatatttgtggttag |
34011845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University