View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9427_low_39 (Length: 258)
Name: NF9427_low_39
Description: NF9427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9427_low_39 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 5543423 - 5543184
Alignment:
| Q |
1 |
cgctgaaatgtgaccacaattacggtcgggttgtgtagcataaaaggtggtttaatttcatataatgattgcggtaatagttgcaggaacatgtgctgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5543423 |
cgctgaaatgtgaccacaattacggtcgggttgtgtagcataaaaggtggtttaatttcatataatgattgcggtaatagttgcaggaacatgtgctgtc |
5543324 |
T |
|
| Q |
101 |
acgtcacaatctttgatattatagagaatcgcgctgaaatgtgaccacaattatggtcgggttgtgtaacataaaaggtggtttaattttataaacaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5543323 |
acgtcacaatctttgatattatagagaatcgcgctgaaatgtgaccacaattatggtcgggttgtgtaacataaaaggtggtttaattttataaacaggt |
5543224 |
T |
|
| Q |
201 |
cattgacttgaacaaaatatttgcttgtttattttctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5543223 |
cattgacttgaacaaaatatttgcttgtttattttctctg |
5543184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 62 - 189
Target Start/End: Complemental strand, 5543492 - 5543366
Alignment:
| Q |
62 |
ataatgattgcggtaatagttgcaggaacatgtgctgtcacgtcacaatctttgatattatagagaatcgcgctgaaatgtgaccacaattatggtcggg |
161 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||| | |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5543492 |
ataatgatcgcggtaatagttgcagtaacatgtacagtcacgtcacaatctttgatat-ataaagaatcgcgctgaaatgtgaccacaattacggtcggg |
5543394 |
T |
|
| Q |
162 |
ttgtgtaacataaaaggtggtttaattt |
189 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
5543393 |
ttgtgtagcataaaaggtggtttaattt |
5543366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University