View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9427_low_42 (Length: 251)
Name: NF9427_low_42
Description: NF9427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9427_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 39779725 - 39779971
Alignment:
| Q |
1 |
tagattacttagaactcaagaaataaaacaagttgcgctagcatgttcacttatagattaattactctgttctctcaaaggaatggtaaatttgagattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39779725 |
tagattacttagaactcaagaaataaaacaagttgcgctaacatgttcacttatagattaattactctgttctctcaaaggaatggtaaatttgagattt |
39779824 |
T |
|
| Q |
101 |
accatgcattcaaaagaaaattgtgaatgtccttctcagtttgaaacaccgtctaaatcacgtctttcaacnnnnnnnnattaacttttaaaagagagat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||| |
|
|
| T |
39779825 |
accatgcattcaaaagaaaattgtgaatgtccttctcagtttgaaacaccgtctaaatcacgtctttcaacttttttttattagcttttaaaaga-agat |
39779923 |
T |
|
| Q |
201 |
tgtgaatgtccttctcaatattttttctgttggtg-atgtccatctca |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
39779924 |
tgtgaatgtccttctcaatattttttctgtttgtgaatgtccatctca |
39779971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University