View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9428_low_39 (Length: 211)
Name: NF9428_low_39
Description: NF9428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9428_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 1370872 - 1370700
Alignment:
| Q |
20 |
gaggcttcaagagttctgctttaaaagggaagacctgtattggaaatatttagaattgatcaatgttcatttcgatattaaagatccaatgataattgac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1370872 |
gaggcttcaagagttctgctttaaaagggaatacctgtattggaaatatttagaattgatcaatgttcatttcgatattaaagatccaatgataattgac |
1370773 |
T |
 |
| Q |
120 |
atttataaatcaaacacatgatttctcaccttatctctaagaaagttcataaccttttcacgaataacatcgt |
192 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1370772 |
atttataaatcaaacacataatttctcaccttatctctaagaaagttcataaccttttcacgaataacatcgt |
1370700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 141 - 186
Target Start/End: Original strand, 34613624 - 34613669
Alignment:
| Q |
141 |
tttctcaccttatctctaagaaagttcataaccttttcacgaataa |
186 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||||||||||||||| |
|
|
| T |
34613624 |
tttctcaccttatctctaacaaaatttataaccttttcacgaataa |
34613669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University