View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9428_low_41 (Length: 209)

Name: NF9428_low_41
Description: NF9428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9428_low_41
NF9428_low_41
[»] chr4 (1 HSPs)
chr4 (32-209)||(467560-467737)


Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 32 - 209
Target Start/End: Complemental strand, 467737 - 467560
Alignment:
32 cctaaacatgcgaatgttatataaatagtattggcatttgaatttgaatgatacatacactgatctagggttttggagttgagcttcattcaaactgatc 131  Q
    ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
467737 cctaaacatgccaatgttatataaatagtattgccatttgaatttgaatgatacatacactgatctagggttttggagttgagcttcattcaaactgatc 467638  T
132 atatcatgtcaaacaacagccgcgaagcaccagagccgacggcagcttctggagatggtggtggtctgtcggagaagc 209  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
467637 atatcatgtcaaacaacagccgcgaagcaccagagctgacggcagcttctggagatggtggtggtctgtcggagaagc 467560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University