View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9428_low_41 (Length: 209)
Name: NF9428_low_41
Description: NF9428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9428_low_41 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 32 - 209
Target Start/End: Complemental strand, 467737 - 467560
Alignment:
| Q |
32 |
cctaaacatgcgaatgttatataaatagtattggcatttgaatttgaatgatacatacactgatctagggttttggagttgagcttcattcaaactgatc |
131 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
467737 |
cctaaacatgccaatgttatataaatagtattgccatttgaatttgaatgatacatacactgatctagggttttggagttgagcttcattcaaactgatc |
467638 |
T |
 |
| Q |
132 |
atatcatgtcaaacaacagccgcgaagcaccagagccgacggcagcttctggagatggtggtggtctgtcggagaagc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
467637 |
atatcatgtcaaacaacagccgcgaagcaccagagctgacggcagcttctggagatggtggtggtctgtcggagaagc |
467560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University