View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9429_high_1 (Length: 284)
Name: NF9429_high_1
Description: NF9429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9429_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 124 - 273
Target Start/End: Original strand, 2782046 - 2782197
Alignment:
| Q |
124 |
ttctatgtgatgtgattgttcccatcaaactatgatactatgatctgcaatgttattttctttaattattgtttttctggtgactgtttcctaccctgc- |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782046 |
ttctatgtgatgtgattgttcccatcaaactatgatattatgatctgtaatgttattttctttaattattgtttttctggtgactgtttcctaccctgcc |
2782145 |
T |
 |
| Q |
223 |
---cttgtactattttgctatatttatattattatgaagtgtttttgtcaagta |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2782146 |
ttacttgtactattttgctatatttatattattat--agtgtttttgtcaagta |
2782197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 2781891 - 2782022
Alignment:
| Q |
1 |
actcccctgcctcttttcactaaa-gcaagaattgacttttcaccttatatatccaaacatgaaatggtgatttttggttggcagtccgttctttatagc |
99 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2781891 |
actcccctgcctcttttcactaaaagcaagaatggacttttcaccttatatatccaaacatgaaatggtgatttttggttggcagtccgttctttgtagc |
2781990 |
T |
 |
| Q |
100 |
ggctttttgatgttgcgaattgctttctatgt |
131 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
2781991 |
ggctttttgatgttgcgaattgctttatatgt |
2782022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 6 - 131
Target Start/End: Complemental strand, 25560553 - 25560430
Alignment:
| Q |
6 |
cctgcctcttttcactaaa-gcaagaattgacttttcaccttatatatccaaacatgaaatggtgatttttggttggcagtccgttctttatagcggctt |
104 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| ||||||||||||| | |||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
25560553 |
cctgcctcttttcactaaaagcaagaatggacatttcaccttatat---ccaacatgaaatggtgatttttggctggcagtccgttctctatagcggctt |
25560457 |
T |
 |
| Q |
105 |
tttgatgttgcgaattgctttctatgt |
131 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
25560456 |
tttgatgttgcgaattgctttatatgt |
25560430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University