View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9429_low_7 (Length: 220)
Name: NF9429_low_7
Description: NF9429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9429_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 12 - 202
Target Start/End: Original strand, 32680060 - 32680250
Alignment:
| Q |
12 |
aagcagagagggctacaataaaaagtcttaatattttggtataaattcccttgattgagaagctttcaaaacctatgttgtcaatcgtggatcgaggaaa |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32680060 |
aagcacagagggctacaataaaaagtcttaatattttggtataaattcccttgattgagaagctttcaaaacctatgttgtcaatcgtggatcgaggaaa |
32680159 |
T |
 |
| Q |
112 |
actctgattgactcatttgtctcttattaaaaggatcagagggagtatctgacaatgtaaaccaaagcactacaaagacagacaaattagt |
202 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32680160 |
actctgattgactcatttgtctcctattaaaaggattagagggagtatctgacaatgtaaaccaaagcactacaaagacagacaaattagt |
32680250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 23 - 103
Target Start/End: Complemental strand, 44806454 - 44806374
Alignment:
| Q |
23 |
gctacaataaaaagtcttaatattttggtataaattcccttgattgagaagctttcaaaacctatgttgtcaatcgtggat |
103 |
Q |
| |
|
||||||| |||||||||||| ||| |||||||||||||| ||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
44806454 |
gctacaaggaaaagtcttaatgatttcgtataaattcccttaattcagaagctttcaaaacctatgttgtcaatagtggat |
44806374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University