View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9430_low_1 (Length: 370)
Name: NF9430_low_1
Description: NF9430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9430_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 235 - 300
Target Start/End: Original strand, 17725049 - 17725115
Alignment:
| Q |
235 |
atgaattgattggtggtactagtgcaaggttgattacagtggaaatataatgaaa-aacacccactt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17725049 |
atgaattgattggtggtactagtgcaaggttgattacagtggaaatataatgaaataacacccactt |
17725115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 13 - 79
Target Start/End: Complemental strand, 37167367 - 37167301
Alignment:
| Q |
13 |
attattctgaattggactatgattcatggaagtaaatattggcctattagagcatgataaacttgta |
79 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||| || |||||| |
|
|
| T |
37167367 |
attattctgaattggactatgattcatgaaagtatatattggcctattggagcatgacaagcttgta |
37167301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 113 - 158
Target Start/End: Complemental strand, 37167242 - 37167197
Alignment:
| Q |
113 |
catgttgttactttcattacaagtgtttagagtttgaagattttga |
158 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
37167242 |
catgttgttactttcattataagtgtatagagtttgaagattttga |
37167197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 301 - 351
Target Start/End: Original strand, 41225946 - 41225996
Alignment:
| Q |
301 |
gaggatttggtgagggagtgctctggatttttgcataatattgttttgcag |
351 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41225946 |
gaggagttggtgagggagtgctctgtttttttgcataatattgttttgcag |
41225996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 301 - 362
Target Start/End: Original strand, 36480871 - 36480932
Alignment:
| Q |
301 |
gaggatttggtgagggagtgctctggatttttgcataatattgttttgcagaataatctacc |
362 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||||||||||| |||||||| ||||| |||| |
|
|
| T |
36480871 |
gaggatttggtgaaggagagctctgtatttttgcataatattattttgcaggataatgtacc |
36480932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 301 - 357
Target Start/End: Complemental strand, 45814551 - 45814495
Alignment:
| Q |
301 |
gaggatttggtgagggagtgctctggatttttgcataatattgttttgcagaataat |
357 |
Q |
| |
|
|||||| |||||||||||||||||| ||| | ||||||| ||||||||||| ||||| |
|
|
| T |
45814551 |
gaggatatggtgagggagtgctctgtattatagcataattttgttttgcaggataat |
45814495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University