View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9430_low_4 (Length: 311)
Name: NF9430_low_4
Description: NF9430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9430_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 128 - 293
Target Start/End: Original strand, 33826104 - 33826269
Alignment:
| Q |
128 |
ctcttgacttggtatcctatgtgtttcctatttatactccaagtcatgcacgtttttatttattacactacctagtcaaaatggcagttgcaattcactt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33826104 |
ctcttgacttggtatcctatgtgtttcctatttatattccaagtcatgcacgtttttatttattacactacctagttaaaatggcagttgcaattcactt |
33826203 |
T |
|
| Q |
228 |
ggtcatatcattgaaagctttgaatctttctactgtactttcggtttcaatttccacttaaatagg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
33826204 |
ggtcatatcattgaaagctttgaatctttctactgcactcacggtttcaatttccacttaaatagg |
33826269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 128 - 276
Target Start/End: Complemental strand, 53838016 - 53837867
Alignment:
| Q |
128 |
ctcttgacttggtatcctatgtgtttcctatttatactccaagtcatgcacgttttt-atttattacactacctagtcaaaatggcagttgcaattcact |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||||||||| |
|
|
| T |
53838016 |
ctcttgacttggtatcctatgtgtttcctatttatactccaagtcatgcacgttttttatttattacattacctggtcaaaatggtagttgcaattcact |
53837917 |
T |
|
| Q |
227 |
tggtcatatcattgaaagctttgaatctttctactgtactttcggtttca |
276 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
53837916 |
tggtcataacattgaaagctttgaatcattctaccacactttcggtttca |
53837867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 137 - 275
Target Start/End: Complemental strand, 53834427 - 53834289
Alignment:
| Q |
137 |
tggtatcctatgtgtttcctatttatactccaagtcatgcacgt-ttttatttattacactacctagtcaaaatggcagttgcaattcacttggtcatat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53834427 |
tggtatcctatgtgtttcctatttatactccaagtcatgcacgttttttatttattacattacctagtcaaaatggcagttgcaattcacttgg-cataa |
53834329 |
T |
|
| Q |
236 |
cattgaaagctttgaatctttctactgtactttcggtttc |
275 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
53834328 |
cattgaaagctttgaatcattctaccacactttcggtttc |
53834289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 4 - 67
Target Start/End: Original strand, 42564109 - 42564172
Alignment:
| Q |
4 |
gagtttggtgttatgctgcagccactgaatgctatggaaaccattggctctggtatggcatatg |
67 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42564109 |
gagttaggtgttatgctgcagccactaaatgctatggaaaccattggctctggtatggcatatg |
42564172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 5 - 59
Target Start/End: Complemental strand, 42957057 - 42957003
Alignment:
| Q |
5 |
agtttggtgttatgctgcagccactgaatgctatggaaaccattggctctggtat |
59 |
Q |
| |
|
|||| |||||| ||| ||| |||||||||||||||| ||||||||||||| |||| |
|
|
| T |
42957057 |
agttaggtgttctgccgcaaccactgaatgctatggcaaccattggctctagtat |
42957003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University