View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9430_low_9 (Length: 205)
Name: NF9430_low_9
Description: NF9430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9430_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 16 - 87
Target Start/End: Complemental strand, 18055246 - 18055175
Alignment:
| Q |
16 |
taggatagtagtggagcatcaactttgcatgtccaacaaattttccgacaaagattaatcacgttaaatggt |
87 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18055246 |
taggataggagtggagcatcaactttgcatgtccaacaaattttccgacaaagattaatcacgttaaatggt |
18055175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 122 - 189
Target Start/End: Complemental strand, 18055169 - 18055102
Alignment:
| Q |
122 |
tctctaagtctctttctattttggcagctgctggattgggctctagggaaagaacaatcagttcttct |
189 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18055169 |
tctctaagtctctttgtattttggcagctgctggattgggctctagggaaagaacattcagttcttct |
18055102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University