View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9431_low_13 (Length: 264)
Name: NF9431_low_13
Description: NF9431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9431_low_13 |
 | |
|
| [»] scaffold0596 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0596 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: scaffold0596
Description:
Target: scaffold0596; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 137 - 256
Target Start/End: Original strand, 8078 - 8197
Alignment:
| Q |
137 |
tatgatatttaatctaataaagtcttcactattggtgatgttattttccacgaggatatttttctctataaatccatttcttcttcaccacctaaaacag |
236 |
Q |
| |
|
||||||||| ||||||||||||||||||||| | |||||| |||||||||||||||||||||| |||| |||| ||||||||||||||||||||||||| |
|
|
| T |
8078 |
tatgatattgaatctaataaagtcttcactagtcatgatgtcattttccacgaggatatttttccctatgaatcaatttcttcttcaccacctaaaacag |
8177 |
T |
|
| Q |
237 |
attctgtcataccctttgct |
256 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
8178 |
attctgtcatacccattgct |
8197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 137 - 250
Target Start/End: Original strand, 47751056 - 47751169
Alignment:
| Q |
137 |
tatgatatttaatctaataaagtcttcactattggtgatgttattttccacgaggatatttttctctataaatccatttcttcttcaccacctaaaacag |
236 |
Q |
| |
|
||||||||| |||||||| |||||||||||| | ||||||| ||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
47751056 |
tatgatattgaatctaattaagtcttcactagtcgtgatgtcattttccacaaggatatttttccctatgaatccatttcttcttcaccacctaaaacag |
47751155 |
T |
|
| Q |
237 |
attctgtcataccc |
250 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
47751156 |
attatgtcataccc |
47751169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University