View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9431_low_19 (Length: 240)
Name: NF9431_low_19
Description: NF9431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9431_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 50 - 225
Target Start/End: Complemental strand, 12890860 - 12890689
Alignment:
| Q |
50 |
tagatagatccaattagttgtttcacccctttatttcaatgtactaactagatgtttagctctacattatgctttgtattttgctgctagaaccatctac |
149 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12890860 |
tagatagatccaattagttgtttcactcctttatttcaatgtacta----gatgtttagctctacattatgctttgtattttgctactagaaccatctac |
12890765 |
T |
|
| Q |
150 |
atttgtaatgtttttgggttgttttgaacttacgtgttcctctcaaactaggattcctttaaaacgagatacaaat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12890764 |
atttgtaatgtttttgggttgttttgaacttacgtgttcctctcaagctaggattcctttaaaacgagatacaaat |
12890689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 29 - 106
Target Start/End: Complemental strand, 12893647 - 12893570
Alignment:
| Q |
29 |
tgtgtttaaagtttcaattgttagatagatccaattagttgtttcacccctttatttcaatgtactaactagatgttt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| || | |||||||||||||||||||| ||||||||| |
|
|
| T |
12893647 |
tgtgtttaaagtttcaattgttagatagaaccaattagttggttgattcctttatttcaatgtactaagtagatgttt |
12893570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 222
Target Start/End: Complemental strand, 12884723 - 12884667
Alignment:
| Q |
166 |
ggttgttttgaacttacgtgttcctctcaaactaggattcctttaaaacgagataca |
222 |
Q |
| |
|
|||||||||||| ||||||| ||||||| || ||| |||||||||||| |||||||| |
|
|
| T |
12884723 |
ggttgttttgaaattacgtgctcctctccaagtagaattcctttaaaatgagataca |
12884667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University