View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9431_low_20 (Length: 239)
Name: NF9431_low_20
Description: NF9431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9431_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 7078297 - 7078373
Alignment:
| Q |
1 |
ccccaatagtgggtagttttctacacatg-tgtaatcactagcttttatgctatcattgaatgaaatatcctctttt |
76 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7078297 |
ccccaatagtgggtagttttctacacatggtgtaatcactagcttttatgctatcattgaatgaaatatcatctttt |
7078373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 8814382 - 8814306
Alignment:
| Q |
1 |
ccccaatagtgggtagttttctacacatg-tgtaatcactagcttttatgctatcattgaatgaaatatcctctttt |
76 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8814382 |
ccccaatagtgggtagttttctacacatggtgtaattactagcttttatgctatcattgaatgaaatatcctctttt |
8814306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 7 - 75
Target Start/End: Original strand, 26360897 - 26360966
Alignment:
| Q |
7 |
tagtgggtagtttt-ctacacatgtgtaatcactagcttttatgctatcattgaatgaaatatcctcttt |
75 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
26360897 |
tagtgggtagtttttctacacatgtgtaatctctagcttttaagctatcattgaatgaaatatccacttt |
26360966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 2 - 77
Target Start/End: Original strand, 21968620 - 21968696
Alignment:
| Q |
2 |
cccaatagtgggtagttttctacacatg-tgtaatcactagcttttatgctatcattgaatgaaatatcctcttttt |
77 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||| ||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
21968620 |
cccaatagtgaatagttttctacacatggtgtaatcattagcttttaaactatcattaaatgaaatatcctcttttt |
21968696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University