View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9431_low_6 (Length: 355)
Name: NF9431_low_6
Description: NF9431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9431_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 4e-97; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 17 - 232
Target Start/End: Original strand, 35291538 - 35291753
Alignment:
| Q |
17 |
agggggaaaagattaaagtatgaagtagtcgttgctgggtagaaaatgggaaaaaccaatgtattaagcaatggttaaaattctcgtttgagttggtcga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35291538 |
agggggaaaagattaaagtatgaagtagtcgttgctgggtagaaaatggaaaaaaccaatgtattaagcaatggttaaaattctcgtttgagttggttga |
35291637 |
T |
|
| Q |
117 |
ttaaactgcgaatggatcgattcttctgagaatcgagtagtttatcggttggtttaatttcagttatattgtatgatggttgaaatgattcagatgtgaa |
216 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| | | |
|
|
| T |
35291638 |
ttaaactgcgaatggatcgattcatatgagaatcgagtagtttatcggttggtttaatttcagttagattgtaagatggttgaaatgattcagatgcgga |
35291737 |
T |
|
| Q |
217 |
ttttgactggtttaac |
232 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
35291738 |
ttttgattggtttaac |
35291753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 298 - 355
Target Start/End: Original strand, 35291819 - 35291876
Alignment:
| Q |
298 |
cgaaatcacgcatatttaagttggttgaaccaaactattttctcgattgcttcaactt |
355 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35291819 |
cgaaatcacgcgtatttaagttggttgaaccaaactattttctcgattgcttcaactt |
35291876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University