View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9433_low_4 (Length: 280)
Name: NF9433_low_4
Description: NF9433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9433_low_4 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 72 - 280
Target Start/End: Complemental strand, 39850791 - 39850583
Alignment:
| Q |
72 |
gtgacaacgaaacagacaaatcaatttgtgtcactaacaataacaccattttactattttgaccatgacattaactacatgattctaatagccttagact |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39850791 |
gtgacaacgaaacagacaaatcaatttgtgtcactaacaataacaccattttactattttgaccatgacattaactacatgattctaatagtcttagact |
39850692 |
T |
 |
| Q |
172 |
tattaggttttgatgattgtcgttcttacgttaaattaagggggtctagttcttagttgatctcaaatatccaccgatcaattgaactaggaaaagtgtg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39850691 |
tattaggttttgatgattgtcgttcttacgttaaattaagggggtctagttcttagttgatctcaaatatcgaccgatcaattgaactaggaaaagtgtg |
39850592 |
T |
 |
| Q |
272 |
aaaagatca |
280 |
Q |
| |
|
||||||||| |
|
|
| T |
39850591 |
aaaagatca |
39850583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University