View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9435_low_2 (Length: 263)

Name: NF9435_low_2

Description: NF9435

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF9435_low_2

[»] chr1 (2 HSPs)

[»] chr4 (1 HSPs)

Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 2)

Name: chr1

Description:

Target: chr1; HSP #1

Raw Score: 61; E-Value: 3e-26

Query Start/End: Original strand, 172 - 247

Target Start/End: Complemental strand, 39936783 - 39936707

Alignment:

Q	172	ccacaattgct-catatttgtgttgagtaattgaaagtgatgatgttgcaaatttggattattacacgagaaagaag	247	Q
		\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|
T	39936783	ccacaattgctgcatatttgtgttgagtaattgaaagtgatgatgttgcaaatttagattattacatgagaaagaag	39936707	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2

Raw Score: 47; E-Value: 6e-18

Query Start/End: Original strand, 15 - 113

Target Start/End: Complemental strand, 39936890 - 39936795

Alignment:

Q	15	ctgtgctcttctccagtgagagttcatgttatgaatttcnnnnnnngttcaaaggatgaatcgaaaattaattaaaaatggatttagtttgttatatga	113	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	39936890	ctgtgctcttctccggtgagagttcatgttatgaatt---attatttttcaaaggatgaataaaaaattaattgaaaatggatttagtttgttatatga	39936795	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)

Name: chr4

Description:

Target: chr4; HSP #1

Raw Score: 30; E-Value: 0.00000009

Query Start/End: Original strand, 68 - 113

Target Start/End: Original strand, 20209017 - 20209062

Alignment:

Q	68	ggatgaatcgaaaattaattaaaaatggatttagtttgttatatga	113	Q
		\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|
T	20209017	ggatgaatagaaaattaattgaaaatgggtttagcttgttatatga	20209062	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]