View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9436_low_14 (Length: 216)

Name: NF9436_low_14
Description: NF9436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9436_low_14
NF9436_low_14
[»] chr6 (1 HSPs)
chr6 (39-153)||(3762578-3762692)


Alignment Details
Target: chr6 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 39 - 153
Target Start/End: Complemental strand, 3762692 - 3762578
Alignment:
39 tcttttcaatctatatttctacttgattgattagttgttaaaaaacaatgccgttttccaacttcttcctccgacaacaacctccagtcatctattgatt 138  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |    
3762692 tcttttcaatctatatttctacttgattgatttgttgttaaaaaacaaagccgttttccaacttcatcctccgacaacaacctccagtcatctattgagt 3762593  T
139 actggaatcgtcgat 153  Q
    |||||||||||||||    
3762592 actggaatcgtcgat 3762578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University