View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9436_low_14 (Length: 216)
Name: NF9436_low_14
Description: NF9436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9436_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 39 - 153
Target Start/End: Complemental strand, 3762692 - 3762578
Alignment:
| Q |
39 |
tcttttcaatctatatttctacttgattgattagttgttaaaaaacaatgccgttttccaacttcttcctccgacaacaacctccagtcatctattgatt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
3762692 |
tcttttcaatctatatttctacttgattgatttgttgttaaaaaacaaagccgttttccaacttcatcctccgacaacaacctccagtcatctattgagt |
3762593 |
T |
 |
| Q |
139 |
actggaatcgtcgat |
153 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3762592 |
actggaatcgtcgat |
3762578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University