View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9436_low_7 (Length: 351)
Name: NF9436_low_7
Description: NF9436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9436_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 16 - 164
Target Start/End: Complemental strand, 31446186 - 31446038
Alignment:
| Q |
16 |
agatatacatttctaataattgtatatccggtcctttgaatgagatttgtaatgtcgagcctgtttcacattttctacagcacgatttattgcattcatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31446186 |
agatatacatttctaataattgtatatccggtcctttgaatgagatttgtaatatcgagcctgtttcacattttctacagcacgatttattgcattcatg |
31446087 |
T |
|
| Q |
116 |
tgtgtgggatcttcggtcttccaggaatagagtaatttttaaggggaaa |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31446086 |
tgtgtgggatcttcggtcttccaggaatagagtaatttttaaggggaaa |
31446038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University