View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9438_3 (Length: 465)
Name: NF9438_3
Description: NF9438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9438_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 133 - 436
Target Start/End: Complemental strand, 27844457 - 27844154
Alignment:
| Q |
133 |
tatttctaaacagccatgaggatgagtatacaaaaatgaaattgatgaaatagaatgatcctttcaaagacactaaaaaggagtgcatgatctctacggt |
232 |
Q |
| |
|
|||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27844457 |
tatttctatatagctatgaggatgagtatacaaaaatgaaattgatgaaatagaatgatcctttcaaagagactaaaaaggagtgcatgatctctacggt |
27844358 |
T |
|
| Q |
233 |
ggaatttcagaaagcctacgatttggtaagttggagtttttgggattacatgctttaaagattcaacttcaatgaaaaatgaagaggttggatgagggct |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27844357 |
ggaatttcagaaagcctacgatttggtaagttggagtttttgggattacatgctttaaagattcaacttcgatgaaaaatgaagaggttggatgagggct |
27844258 |
T |
|
| Q |
333 |
tctgtattttcggataatttgttggtattggcgaatgggattcccatggaagagatgaaaattagtagcgggcttatgcaaggtgatctgttagcaccct |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27844257 |
tctgtattttcggataatttgttggtattggcgaatgggattcccatggaagagatgaaaattagtagcgggcttatgcaaggtgatctgttagtaccct |
27844158 |
T |
|
| Q |
433 |
tttg |
436 |
Q |
| |
|
|||| |
|
|
| T |
27844157 |
tttg |
27844154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University