View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9438_low_4 (Length: 251)
Name: NF9438_low_4
Description: NF9438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9438_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 91
Target Start/End: Complemental strand, 54005396 - 54005320
Alignment:
| Q |
15 |
attctacatgcaattttattatttatcactttaaaacaagaaatttatgttgaatgactccgcttccaagtaaggtg |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
54005396 |
attctacatgcaattttattatttatcactttaaaacaagaaatttatgttgaatgactccgctaacgagtaaggtg |
54005320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 126 - 175
Target Start/End: Complemental strand, 54005285 - 54005236
Alignment:
| Q |
126 |
agatgcatgtctgctgctcttccacttcactattcatcttctatcatata |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54005285 |
agatgcatgtctgctgctcttccacttcactattcatcttctatcatata |
54005236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 210 - 251
Target Start/End: Complemental strand, 54005202 - 54005161
Alignment:
| Q |
210 |
ctcaatcaaataggtatcatgtcaggtggttctttttgggtt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54005202 |
ctcaatcaaataggtatcatgtcaggtggttctttttgggtt |
54005161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University