View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9439_low_27 (Length: 263)
Name: NF9439_low_27
Description: NF9439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9439_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 2064719 - 2064466
Alignment:
| Q |
1 |
ctctctgttgccacgctttccatgctgaatgcattgacacatggctccgttcaaatctttcatgtccgttatgtcgctccagcattctcccttccgattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2064719 |
ctctctgttgccacgctttccatgctgaatgcattgacacatggctccgttcaaatctttcatgtccgttatgtcgcgccagcattctcccttccgattc |
2064620 |
T |
|
| Q |
101 |
tgatctcgcgaaaattctccgatcaacttcttcagacagtttccgagttgatatcggaaatataagccgccgtggaaacaatcttcccaatcccgacgcc |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064619 |
tgatctcgcaaaaattctccgatcaacttcttcagacagtttccgagttgatatcggaaatataagccgccgtggaaacaatcttcccaatcccgacgcc |
2064520 |
T |
|
| Q |
201 |
gttactaccggtggcgattcaaggtcttattcaattggatcgtttgagtattat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2064519 |
gttactaccggtggcgattcaaggtcttattcgattggatcgtttgagtattat |
2064466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University