View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9439_low_29 (Length: 253)
Name: NF9439_low_29
Description: NF9439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9439_low_29 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 1949029 - 1948792
Alignment:
| Q |
17 |
aggacgaattgtttaaaagaacctcagttcgatttctagatcgaacaattttttgtcgggcttc-cttacctttcgatcgaagatattattagtaaaaag |
115 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1949029 |
aggacgaattgtttagaagaacctcagttcgatttctagatcgaacaattttttgtcgggcttttcttacctttcgatcgaagatattattagtaaaaag |
1948930 |
T |
 |
| Q |
116 |
aaatcatatcatatctttatcatgctttatattatatcatatctcttgcaatatcatgtgcttcgaactggccgaaacattttaaaattaatttaactct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
1948929 |
aaatcatatcatatctttatcatgctttatattatatcatatctcttgtagtatcatgtgcttcgaactgaccgaaacattttaaaattaatttaattct |
1948830 |
T |
 |
| Q |
216 |
catttacttattcttacagagatataaccctagaatat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1948829 |
catttacttattcttacagagatataaccctagaatat |
1948792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 75
Target Start/End: Complemental strand, 4160705 - 4160653
Alignment:
| Q |
23 |
aattgtttaaaagaacctcagttcgatttctagatcgaacaattttttgtcgg |
75 |
Q |
| |
|
|||||||||| ||||||| ||||| |||||||||| |||||||||||||||| |
|
|
| T |
4160705 |
aattgtttaagagaacctgagttcaatttctagatgtaacaattttttgtcgg |
4160653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 73
Target Start/End: Complemental strand, 7570398 - 7570360
Alignment:
| Q |
35 |
gaacctcagttcgatttctagatcgaacaattttttgtc |
73 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
7570398 |
gaacctgagttcgatttctagattgaacaattttttgtc |
7570360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University