View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9439_low_33 (Length: 250)
Name: NF9439_low_33
Description: NF9439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9439_low_33 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] scaffold0014 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 6623343 - 6623104
Alignment:
| Q |
11 |
caaaggacttaagtgaaggacgatgactcttcagagacaagagttgcaattctgctgctgaagagaaattcaggatgggaattcatgaacttctcgagga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6623343 |
caaaggacttaagtgaaggacgatgactcttcagagacaagagttgcaattctgctgctgaagagaaattcaggaggggaattcatgaacttctcgagga |
6623244 |
T |
|
| Q |
111 |
gagtctagaattttggatgaaattcagtacttctttcactgagatacaaaaatatgtaaccactgcaaaagatttactaatttatgtatcaaaacttgaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
6623243 |
gagtctagaattttggatgaaattcagtacttctttcactgagatacaaaaatatgtaaccactgcaaaagatttactaatttatgtatcaaaacttcaa |
6623144 |
T |
|
| Q |
211 |
gaaaactggaaattatcaataggaatatgattttataaac |
250 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
6623143 |
gaaaactggaaattatcaatatgaatacgattttataaac |
6623104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 11 - 98
Target Start/End: Original strand, 90330 - 90417
Alignment:
| Q |
11 |
caaaggacttaagtgaaggacgatgactcttcagagacaagagttgcaattctgctgctgaagagaaattcaggatgggaattcatga |
98 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
90330 |
caaaggacttaagtgaaggatgatgactcttcagagacaagagttgcagttctgctgttgaagagaaattccggatgggaattcatga |
90417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 150 - 250
Target Start/End: Original strand, 90415 - 90510
Alignment:
| Q |
150 |
tgagatacaaaaatatgtaaccactgcaaaagatttactaatttatgtatcaaaacttgaagaaaactggaaattatcaataggaatatgattttataaa |
249 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
90415 |
tgagatacaaaaatatgtaaccactg-aaaagatttactaatttatgtatcaaaactt----aaaactggaaatcatccgaaggaatatgattttataaa |
90509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 60 - 188
Target Start/End: Complemental strand, 28751910 - 28751782
Alignment:
| Q |
60 |
ttctgctgctgaagagaaattcaggatgggaattcatgaacttctcgaggagagtctagaattttggatgaaattcagtacttctttcactgagatacaa |
159 |
Q |
| |
|
|||||||| ||||||||| || ||||||| || | |||||||||||||||| ||||||||| |||||||||||||| ||||||||||| |||||||| |
|
|
| T |
28751910 |
ttctgctgttgaagagaagtttcggatgggtatcgacgaacttctcgaggagaatctagaattctggatgaaattcagcacttctttcaccgagatacag |
28751811 |
T |
|
| Q |
160 |
aaatatgtaaccactgcaaaagatttact |
188 |
Q |
| |
|
||||| | ||| ||| ||||||||||||| |
|
|
| T |
28751810 |
aaatacgaaacaactacaaaagatttact |
28751782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University