View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9439_low_35 (Length: 249)
Name: NF9439_low_35
Description: NF9439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9439_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 41698672 - 41698912
Alignment:
| Q |
1 |
ttttgctctctttaattactttaatttt--tactgactcgccaaaactttctaaacactaaccgaagtttccgaaactaaaattacagatatattataat |
98 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41698672 |
ttttgctctctttaattactttaatttttttactgactagccaaaactttctaaacactaaccgaagtttccgaaactaaaattacagatatattataat |
41698771 |
T |
 |
| Q |
99 |
gcccataatttcaaaaagaaaaacataagatgtctttgaaacacaccttagtgatgtcttgaatcaactaaatatctgaatttcaagtaggaaagatgtc |
198 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41698772 |
gcccgtaatttcaaaaagaaaaacataagatgtctttgaaacacaccttagtgatgtcttgaatcaactaaatatctgaatttcaagtaggaaagatgtc |
41698871 |
T |
 |
| Q |
199 |
tttgaaatactcaattaggatcctgcggatatcttcctttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41698872 |
tttgaaatactcaattaggatcctgcggatatcttcctttg |
41698912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University