View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9439_low_41 (Length: 241)
Name: NF9439_low_41
Description: NF9439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9439_low_41 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 41698196 - 41698422
Alignment:
| Q |
18 |
cagtccccgagagttcatcccaatacatagggaatttggtttgattattatgaaaaagtgctttgagaagtgattctgattgagg---agtttgagtttg |
114 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41698196 |
cagtccccaagagttcatcccaatacatagggaatttggtttgattattatgaaaaagtgctttgagaagtgattctgattgaggaggagtttgagtttg |
41698295 |
T |
 |
| Q |
115 |
agcaaagggtctaagctgattttgaagtatggtgtcatcagccactctgttttttatcctttgggagaatctttggcctattaagaaacccatttcgtat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41698296 |
agcaaagggtctaagctgattttgaagtatggtgtcatcagccactctgttttttatcctttgggagaatctttggcctattaagaaacccatttcgtat |
41698395 |
T |
 |
| Q |
215 |
gaatctttgcatggtccaacttcaaac |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
41698396 |
gaatctttgcatggtccaacttcaaac |
41698422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University