View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9441_low_12 (Length: 288)
Name: NF9441_low_12
Description: NF9441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9441_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 164 - 281
Target Start/End: Complemental strand, 27010626 - 27010509
Alignment:
| Q |
164 |
ctaaataaatattgctcactctagatagtctagagtcaaaaattctaattagaatgagttagaaaataaattccaatgttgcctaaattcacatccataa |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27010626 |
ctaaataaatattgctcactctagatagtctagagtaaaaaatcttaattagaatgagtaagaaaataaattccaatgttgcctaaattcacatccataa |
27010527 |
T |
|
| Q |
264 |
tatgtttccgaccctatg |
281 |
Q |
| |
|
|||||||| |||| |||| |
|
|
| T |
27010526 |
tatgtttctgaccttatg |
27010509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 94
Target Start/End: Complemental strand, 27010772 - 27010696
Alignment:
| Q |
18 |
aaatctttccactaagacgatttaaacacacagacatcaaaatatatattatttacttacgtaaaaaatacacattg |
94 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27010772 |
aaatctttccactaagaggatttaaacacacagacatcaaaatatatattatttacttacgtaaaaaatacacattg |
27010696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University