View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9441_low_16 (Length: 276)

Name: NF9441_low_16
Description: NF9441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9441_low_16
NF9441_low_16
[»] chr2 (1 HSPs)
chr2 (17-258)||(43585134-43585375)
[»] chr8 (1 HSPs)
chr8 (17-258)||(4190060-4190301)
[»] chr4 (1 HSPs)
chr4 (75-148)||(23339461-23339534)
[»] chr7 (2 HSPs)
chr7 (84-133)||(7655586-7655635)
chr7 (78-145)||(41418460-41418527)
[»] chr5 (1 HSPs)
chr5 (104-220)||(3929549-3929665)
[»] chr1 (1 HSPs)
chr1 (84-133)||(52103081-52103130)


Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 17 - 258
Target Start/End: Original strand, 43585134 - 43585375
Alignment:
17 gacatcaggtgcagctcttgatcctgctggattagtagcagttgctgtttgtcatggttttgctctttttgttgctgtttctgttggagccaacatatct 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43585134 gacatcaggtgcagctcttgatcctgctggattagtagcagttgctgtttgtcatggttttgctctttttgttgctgtttctgttggagccaacatatct 43585233  T
117 ggtggacatgtcaacccagctgtgacctttgggttggctattgggggacagatcactatcctcactggtatcttctactggattgcacaacttcttggtt 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43585234 ggtggacatgtcaacccagctgtgacctttgggttggctattgggggacagatcactatcctcactggtatcttctactggattgcacaacttcttggtt 43585333  T
217 ccatagtagcatgctttctcctcaagtatgccacaggaggct 258  Q
    ||||||| ||||||||||||||||||||||||||||||||||    
43585334 ccatagtggcatgctttctcctcaagtatgccacaggaggct 43585375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 17 - 258
Target Start/End: Complemental strand, 4190301 - 4190060
Alignment:
17 gacatcaggtgcagctcttgatcctgctggattagtagcagttgctgtttgtcatggttttgctctttttgttgctgtttctgttggagccaacatatct 116  Q
    |||||||| ||||||||||||||| || || ||| |||||||||||||||| ||||||||||| ||||||||||||||| | ||||| |||||||| |||    
4190301 gacatcagatgcagctcttgatccagcagggttactagcagttgctgtttgccatggttttgcactttttgttgctgttgcagttggtgccaacatttct 4190202  T
117 ggtggacatgtcaacccagctgtgacctttgggttggctattgggggacagatcactatcctcactggtatcttctactggattgcacaacttcttggtt 216  Q
    ||||| ||||||||||| ||||| |||||||| |||||| |||| |||||||| || ||||||||||||||||||||||||||||| || |||||||| |    
4190201 ggtggtcatgtcaaccctgctgtcacctttggattggctgttggtggacagattaccatcctcactggtatcttctactggattgctcagcttcttggat 4190102  T
217 ccatagtagcatgctttctcctcaagtatgccacaggaggct 258  Q
    |||| || ||||| ||||| ||| ||| || ||| |||||||    
4190101 ccattgttgcatgttttcttctccagtttgtcactggaggct 4190060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 75 - 148
Target Start/End: Original strand, 23339461 - 23339534
Alignment:
75 tttgctctttttgttgctgtttctgttggagccaacatatctggtggacatgtcaacccagctgtgacctttgg 148  Q
    ||||| |||||||||||||| |||||||| || ||||| |||||||||||||||||||| ||||| || |||||    
23339461 tttgcactttttgttgctgtctctgttggtgctaacatttctggtggacatgtcaaccctgctgtcacttttgg 23339534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 84 - 133
Target Start/End: Original strand, 7655586 - 7655635
Alignment:
84 tttgttgctgtttctgttggagccaacatatctggtggacatgtcaaccc 133  Q
    |||||||| |||||||||||||| |||||||||||||||||||| |||||    
7655586 tttgttgccgtttctgttggagcaaacatatctggtggacatgtgaaccc 7655635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 78 - 145
Target Start/End: Complemental strand, 41418527 - 41418460
Alignment:
78 gctctttttgttgctgtttctgttggagccaacatatctggtggacatgtcaacccagctgtgacctt 145  Q
    ||||| ||||||||||| || ||||| || ||||| || ||||||||||||||||| ||||| |||||    
41418527 gctctctttgttgctgtctccgttggtgctaacatctccggtggacatgtcaaccccgctgtcacctt 41418460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 3929549 - 3929665
Alignment:
104 agccaacatatctggtggacatgtcaacccagctgtgacctttgggttggctattgggggacagatcactatcctcactggtatcttctactggattgca 203  Q
    ||||||||| || ||||||||| | ||||||||||| || ||||| || || ||||| ||  | ||||| ||||| |||||| ||||||| ||||||||     
3929549 agccaacatctcaggtggacatttgaacccagctgttacttttggattagccattggaggcaacatcaccatcctaactggtctcttctattggattgcc 3929648  T
204 caacttcttggttccat 220  Q
    ||| | ||||| |||||    
3929649 caattgcttggctccat 3929665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 84 - 133
Target Start/End: Complemental strand, 52103130 - 52103081
Alignment:
84 tttgttgctgtttctgttggagccaacatatctggtggacatgtcaaccc 133  Q
    ||||| |||||||||||||| || ||||| |||||||||||||| |||||    
52103130 tttgtggctgtttctgttggtgcaaacatttctggtggacatgtgaaccc 52103081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University