View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9441_low_21 (Length: 260)
Name: NF9441_low_21
Description: NF9441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9441_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 2 - 75
Target Start/End: Complemental strand, 17461228 - 17461155
Alignment:
| Q |
2 |
ctattttaccattaatgctattgttgtaatgatattagtcttcaactagtttgtcaaagacatgtattaagata |
75 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17461228 |
ctattttaccattaatgctgttgtcgtaatgatattagtattcaactagtttgtcaaagacatgtattaagata |
17461155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 116 - 171
Target Start/End: Original strand, 17455746 - 17455801
Alignment:
| Q |
116 |
ttatatacaagtcatttttacggtgagtataaagacggataatatagtacctatct |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17455746 |
ttatatacaagtcatttttacggtgagtataaagacaaataatatagtacctatct |
17455801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 28 - 115
Target Start/End: Original strand, 775089 - 775177
Alignment:
| Q |
28 |
taatgatattagtcttcaactagtttgtcaaagacatgtattaagatagaccatattcaagtt-acttaaatgagactaataagtttgg |
115 |
Q |
| |
|
||||||||||| | ||| ||||||||||||| || |||||| |||| |||||||||| ||||| ||| ||||||||||||||||||||| |
|
|
| T |
775089 |
taatgatattaatattctactagtttgtcaatgaaatgtatcaagacagaccatatttaagttaactaaaatgagactaataagtttgg |
775177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 775279 - 775328
Alignment:
| Q |
177 |
tctcgactctatctattgtcgtccctctctctcctattatgaactgaaaa |
226 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||| |||| |
|
|
| T |
775279 |
tctcgactctatctattgtcgtccctcttcctactattatgaactcaaaa |
775328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University