View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9441_low_26 (Length: 245)
Name: NF9441_low_26
Description: NF9441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9441_low_26 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-128; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 11 - 245
Target Start/End: Original strand, 37756677 - 37756911
Alignment:
| Q |
11 |
agaccaactatttgtgctagactatgatggttattttatgaaatttatttttaattaaagaaatgtgttgaatcaaatgatgattcataagattgccatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37756677 |
agaccaactatttgtgctagactatgatggtttttttatgaaatttatttttaattaaagaaatgtgttgaatcaaatgatgattcataagattgccatg |
37756776 |
T |
|
| Q |
111 |
cttgccaattgggtacatcatatatgataccatgcatatatgtcataacagtactttggtttatttgtgatttgcaggtttgctcctcgttaatactgta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37756777 |
cttgccaattgggtacatcatatatgataccatgcatatatgtcataacagtactttggtttatttgtgatttgcaggtttgctcctcgttaatactgta |
37756876 |
T |
|
| Q |
211 |
tcgcaagatcctagatgcaattgaagacaacgatt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37756877 |
tcgcaagatcctagatgcaattgaagacaacgatt |
37756911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 169 - 245
Target Start/End: Original strand, 37751301 - 37751377
Alignment:
| Q |
169 |
gtttatttgtgatttgcaggtttgctcctcgttaatactgtatcgcaagatcctagatgcaattgaagacaacgatt |
245 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| |||||| |||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
37751301 |
gtttatgtgtgatttgcaggtttggtcctcattaatattgtatcgcaaaatcttagatgcaatcgaagacaacgatt |
37751377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University