View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9441_low_31 (Length: 214)
Name: NF9441_low_31
Description: NF9441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9441_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 50229691 - 50229877
Alignment:
| Q |
13 |
aagcagagaacctttttgaagaattttgnnnnnnnnggggtattacttgtaatcttaaataatcttttgagtatttttatagataatcacgaagctttct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50229691 |
aagcagagaacctttttgaagaattttgttttttttggggtattacttgtaatcctaaataatcttttgagtatttttatagataatcacgaagctttct |
50229790 |
T |
|
| Q |
113 |
acgaggatgccgagcttagaaagcagaatgaaggtactcagagaaattgcttctgagaacaatattactctgcagcttgaacaagtt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50229791 |
acgaggatgccgagcttagaaagcagaatgaaggtactcagagaaattgcttctgagaacaatattactctgcagcttgaacaagtt |
50229877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University