View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9441_low_32 (Length: 205)
Name: NF9441_low_32
Description: NF9441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9441_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 45855908 - 45855852
Alignment:
| Q |
18 |
tttactgcataattaagtttccaatacccactactactatccgccgcaaattagactt |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45855908 |
tttactgcataattaagtttccaatacccactactactatcc-ccgcaaattagactt |
45855852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University