View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9443_low_11 (Length: 234)
Name: NF9443_low_11
Description: NF9443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9443_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 40205982 - 40206181
Alignment:
| Q |
17 |
gggaaactaattcaaactatgtttataaggtatgataatgattcaatgtaatgaaggtgaaactttgttactcttctcttagattattatggttgatgac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||| || | |
|
|
| T |
40205982 |
gggaaactaattcaaactatgtttataaggtatgataatgattcaatgtaacgaaggtgaaactttgttactcttcccttagattattatagttggtggc |
40206081 |
T |
 |
| Q |
117 |
tcagtccgtttaccattctcgatataagctaacagttatttcttcctaaatatatcttgtgtcatgagagccaattgttgtcataatatatttcatttta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
40206082 |
tcagtccgtttaccattctcgatataagctaatagtcgtttcttcctaaatacttcttgtgtcatgagagccaattgtcgtcataatatattttatttta |
40206181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University